Keywords
Autochthonous fungus, cellulolytic fungus, microbial additive, diet adaptation, Urochloa decumbens.
Abstract
In this study, we evaluated the productive performance and economic profitably of weaned lambs fed low quality hay and supplemented with a Trichoderma longibrachiatum strain isolated from sheep (ICA/UFMG LT 001). Twelve early-weaned Santa Inês x Dooper lambs were housed in individual pens during 63 days, and randomly split into two groups: (1) lambs receiving the medium without the fungi and (2) lambs receiving 30 ml of culture medium containing the fungal strain. The average daily gain (ADG), dry matter intake (DMI), feed conversion (FC) and feed efficiency (FE) were analyzed in split plots of three periods of 21days and the total weight gain and final body weight were evaluated. The lambs fed the fungal strain showed higher ADG between 21 and 42 days of experiment for (P<0.05) and the increase in total weight gain (1.86 kg) comparing with untreated lambs. However, no significant differences were detected for the DMI, FC and FE. The fungal supplementation reduced into 13.35 % in the cost/kg of live weight and increased the gross and liquid profits by 9.28 % and 13.32 %, respectively. This study was aim evaluate the direct addition of a fungus isolated from the digestive tract of sheep in the diet of recently weaned lambs. We concluded that this supplementation improves the productive performance and economic feasibility until the 42 days of feedlot these young ruminants.
Citation
Santos Magaço FD, Silva Freitas CE, de Moura Freitas AA, Martins Juniror VS, Dos Santos AFF, et al. (2020) Productive performance and economic profitable of weaned lambs supplemented with a Trichoderma longibrachiatum strain isolated from sheep. Int J Anim Sci 4: 6.
Introduction
The low quality of the roughage tropical pastures results in lower nutrient utilization and lower productivity, generating high feeding costs [1,2]. Therefore, when considering this high cost, nutritional alternatives should be evaluated to improve the economic and productive efficiency of ruminants [3].
The use of fungi and their enzymes have been used as additives for ruminant diets improving the use of low-quality fiber and dry matter intake as well as performance and profitability [3-6]. However, there is inconsistency in the results with the use of these additives, especially because type of the fungus species or strains, characteristics of individual animals, ruminant species and age, characteristics of the diets and type of nutritional management [7,4,8].
Ruminants grown in tropical pastures have show a relevant diversity of facultative anaerobic fungi in the rumen [9], which may be important in the degradation of complex food structures by the production of enzymes [10,11]. In a previous study we reported the occurrence of the genera Aspergillus spp., Paecilomyces spp., Acremonium spp., and Trichoderma spp. isolated from the digestive tract of lambs raised on pasture Megathyrsus maximum cv. Tanzania. These fungi may be important in the normal microbiota of this ecosystem and show probiotic or biotechnological potentials [12].
The inclusion of selected fungi from the ruminal environment will improve the utilization of foods containing low quality fiber, resulting in increased economic profitable in the feedlot or pasture creation. In this study we analyzed the productive performance and economic profitable of lambs weaned and the supplemented with a selected fungal strain isolated of sheep raised in tropical pasture.
Material and methods
Location and animals
The trial was carried in north of Minas Gerais, Brazil. The climate of the region is classified as tropical (AW) according to the classification of Köppen [13], marked by a long dry season from April to October. Twelve lambs Santa Inês x Dooper crossbreed, males, uncastrated with 3.5 months and initial body weight (BW) of 18.80 ± 2.34 kg were used. After identification and weighing, the animals were dewormed with 1% ivermectina (0.5 ml / 25 kg bw, Vallée, Minas Gerais Brazil) and Albendazole (1 ml/10 kg bw by oral route, Vallée, Minas Gerais, Brazil), and vaccinated against Clostridiosis (2 ml/animal, Poli-Start Vallée, Minas Gerais, Brazil). The animals were housed in individual stalls with 1.20 m wide, 2 m long and 1.30 m high, equipped with water trough, and provided with troughs to provide the diet.
Experimental design
The experiment was carried out in a completely randomized design to evaluate the groups of lambs fed with the fungi strain and another without the fungi (control) using six replicates (lambs). As a source of bulky food was used only U. decumbens hay wrapped after the seed drop during the dry season and ground (± 19 mm).
The composition of the diets was analyzed by the Combs - Goeser and CNF (NIRS) [14] and balanced for a gain of 200 g/day according to the NRC recommendations [15] in 70% concentrated and 30% voluminous (Table 1). The microbial additive used consisted of a fungi strain (ICA/UFMG LT 001), isolated from the digestive tract of sheep raised on pastures of Megathyrsus maximum cv. Tanzania. One strain of Trichoderma genus was selected because showed higher potential of degradation of crystalline cellulose (Avicel) as described by [12].
Table 1: Diet and nutritional composition feed to feedlot lambs supplemented with fungal strain ICA/UFMG LT 001 for 63 days.
| Ingredient | DM% | EE% | TDN% | CP% | NDF% |
| Maize | 89 | 7.9 | 83.18 | 9 | 16.52 |
| Soybean meal | 88.8 | 1.76 | 80.68 | 46 | 15.54 |
| Ureia + ammonuim sulfate | 100 | 0 | 0 | 277 | 0 |
| Minerals | 100 | 0 | 0 | 0 | 0 |
| Urochloa decumbens hay* | 95.38 | 1.02 | 30.94 | 3.06 | 82.26 |
| Inclusion %, dry matter | |||||
| Maize | 59.1 | 4.7 | 49.2 | 5.3 | 9.8 |
| Soybean meal | 8.3 | 0.1 | 6.7 | 3.8 | 1.3 |
| Ureia + ammonuim sulfate | 0.5 | 0 | 0 | 1.4 | 0 |
| Minerals | 2 | 0 | 0 | 0 | 0 |
| Urochloa decumbens hay | 30 | 0.3 | 30.9 | 3.1 | 24.7 |
| * Additional bromatological composition: ADF = 53.04 % DM; Lignin = 7.50 % DM; Cellulose = 45.54 % DM; Hemicellulose = 29.22 % MS. | |||||
For identification, this strain was grown on Sabouraud agar for seven days, and DNA was extracted according to the method of [16]. The ITS region of rDNA was amplified from the extracted DNA by polymerase chain reaction (PCR) using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC), according to the method of [17]. The amplified product was quantified with a NanoDrop 1000ND (NanoDrop Technologies), and the concentration was adjusted to 100 ng µL-1 for use in sequencing reactions.
Sequencing was performed with DYEnamicTM (Amersham Biosciences, USA) in a MegaBACETM 1000 automated sequencing system at the Genome Analysis Center and Gene Expression of UFMG. The obtained DNA sequences were analyzed using BLASTn (v.2.215) of BLAST 2.0 at the NCBI website [18]. The species Trichoderma longibrachiatum was identified with 100% sequence similarity (1136 dp evaluated, BLAST result, n° acc. GenBank KX463453.1 for T. longibrachiatum SKF-3).
Experimental management
The adaptation of the lambs to the environment and diet occurred in 15 days and 63 days were of data collection. Feeding was administrated at 7:00 a.m. and 3:00 p.m., adjusted to keep 15% of the offered. At the moment of feeding, a group of animals was supplemented with 30 ml of the culture medium containing the fungal strain (109 colony-forming unit (CFU)/ ml and mixed with 100 g of the concentrate, which allowed total intake of the supplement. The lambs of the control group received the same the culture medium without the fungal strain. Water was supplied ad libitum to animals in individual water trough.
The total food provided and the leftovers were weighed daily to evaluate the individual intake of the animals. Weight gain assessments were performed weekly by weighing in the morning before the first meal of the day.
Evaluation of dry matter intake and productive performance
The dry matter intake (DMI) g/animal/day was evaluated in three feeding periods with 21 days each (1st period of 0-21 days, 2nd period of 21-42 days and 3rd period of 42-63 days). The productive performance was evaluated by measuring the final body weight (FBW, kg), average daily gain (ADG) g/animal/ day considering the three periods of analysis and total weight gain (TWG, kg). The DMI/DWG ratio was calculated for feed conversion (FC g/g) evaluation.
Economic profitable
The economic profitable was expressed in gross profit (GP) and net profit (NP) according to [19]. The price of the stuffs used in the diets was used to estimate the cost of the diet (CD) based on the dry matter. Considering the dietary parameters, the costs of kg of live weight (CLW) = CD/total feedlot weight gain; gross profit (GP) = FBW x price of kg of live weight and net profit (NP) = GP – CD, were calculated.
Statistical analysis
After normality and homogeneity verification, the ADG, DMI, FC and FE characteristics were analyzed in a split plot considering the two treatments, 3 periods (as measures repeated in time) and the interaction between the treatments and periods, by the statistical model:
Yijk = m + Ai + Bj + Ck + (A x C) ik + ebijk
where: Yijk is the observation; m is the overall mean; Ai is the effect of treatments (i = 2); Bj is the random effect of the animals (n = 6); Ck is the effect of the periods (k = 3); (A x C) ik is the fixed effect of the interaction between treatments and periods and ebijk is the effect of experimental error.
The TWG and FBW characteristics were submitted to simple analysis of variance by the statistical model:
Yijk = m + Ai + eaij
where Yijk is the observation; m is the overall mean, Ai is the effect of the treatments, Bj is the random effect of the animals and eaij is the experimental error. Differences were considered significant statistically when (P<0.05) or with tendency when (P<0.1) by the t test. Regression analysis was promoted to model weight gain during the experimental period and, the determination coefficient were used to select the model. Descriptive statistics were applied for the economic profitable evaluation.
Results
Productive performance and dry matter intake
The initial body weight (IBW) for both groups was similar, but the final body weight (FBW) tended to be higher (6.8%) in animals supplemented with the fungal strain (P<0.1), which presented higher ADG (226.45 g/day x 196.82 g/day) (Table 2, P<0,001). However, no differences were observed between treatments for DMI, FC and FE (Table 2, P>0.05).
Table 2: Productive performance, dry matter intake and feed conversion for lambs weaned and supplemented or not with fungal strain ICA/UFMG LT 001.
| Treatments effects | P-value | |||||
| Items | Control | Fungal strain | Standard error | Treat1 | Per2 | Interaction3 |
| IBW (kg) | 19.05 | 19.44 | 0.978 | 0.501 | - | - |
| ADG (g/day) | 196.82 | 226.45 | 0.021 | 0.047 | < 0.001 | <0.031 |
| DMI (g/day) | 976.31 | 1036.14 | 44.14 | 0.362 | < 0.001 | 0.319 |
| FC | 4.96 | 4.57 | 0.32 | 0.97 | 0.285 | 0.669 |
| IBW = Initial body weight; ADG = Average daily gain; DMI = Dry matter intake; FC = Feed conversion. 1 Treatments; 2 Periods. 3 Treatments and periods interaction. | ||||||
Significant interaction was observed between the treatments and the periods evaluated for ADG (P<0.031), with the hug growth observed in the period between 21 and 42 days of feedlot (Figure 1) for the group supplemented with the fungal strain (P<0.05).
Figure 1: Average daily gain in three periods of 21 day for lambs weaned and supplemented or not with fungal strain ICA/UFMG LT 001
Values with similar case-capitalized letters between the periods and lowercase between treatments within each period do not differ at P<0.05.
In the control group, the ADG did not present significant changes in the evaluated periods. For DMI, FC and FE, the interaction between the treatments and the periods evaluated was not significant, although it presented differences (P<0.05) between the periods evaluated for DMI and a tendency for better FE in the group supplemented with the fungal strain (P <0.1) (Table 2).
By regression analysis, the third-degree polynomial model explained 64.9% of the ADG variation for the group supplemented with the fungal strain during the evaluation period (*P <0.05, Y=361.28*-148.93xns + 40.83x2ns-3.03x3*)
However, none of the mathematical models evaluated explained the variation for ADG of the group that did not receive the fungal strain since it remained constant during the experiment.
Economic profitable
The group of animals supplemented with the fungal strain presented higher TWG (14.26 kg), which resulted in a reduction of cost/kg of weight produced and consequently, there was an increase of 9.28 % and 13.32 % in gross and net profit, respectively, of the animals supplemented with the fungal strain (Table 3).
Table 3: Cost of the diet, gross and net profit for lambs weaned and supplemented or not with fungal strain ICA/UFMG LT 001.
| Treatmentes effects | |||
| Items | Control | Fungal strain | SEMa |
| Cost of the diet | 31.8 | 32.8 | 1.65 |
| Seeling price (US$/kg) | 2.61 | 2.61 | -- |
| Cost/kg of body weight | 2.6 | 2.29 | 0.25 |
| Gross profit (US$/animal) | 80.3 | 87.75 | 7.67 |
| Net profit (US$/animal) | 48.49 | 54.95 | 6.17 |
| a Standard error of mean | |||
Discussion
Productive performance and dry matter intake The use of microbial and probiotic additives in the ruminant’s diet may improve feed utilization and consequently profit performance. In this study, the addition of the fungal strain promoted an increase at 15.05% for ADG, and this increase was not associated with a significant increase in DMI (Table 2). The addition of the fungi strain in the diet of the young lambs could improve the fibrolytic activity in the rumen. This may be justified by the ability of this fungal specie to produce cellulase, hemicellulase, xylanase, glucanase, important enzymes in the degradation of complex constituent of the vegetal cell wall [20-22].
The variation of ADG observed during the experimental period could be the result of the physiological and behavioral modifications in the young animals (Figure 1). The lowest ADG observed in the first experimental period (0-21 days) (Figure 1) could be justified because the animals were early weaned and therefore had a low capacity for eating fibrous food during this period. However, the addition of the fungal strain could have contributed to the improvement of the ruminal ecosystem and favored the fibrolytic microbiota and, consequently, the use of the low-quality hay. This improvement may have contributed to better nutrient supply to animals and increased ADG up to approximately four weeks of supplementation (Figure 1). During the end period (42-63 days), the ADG averages were similar between the two lamb groups. Possibly, after 42 days, the untreated lambs already could be adapted to the diet, and this fungi supplementation would not be more important.
The improvement in the ADG, without significant changes in DMI, observed in this research may be based on the improvement of the hydrolytic capacity of the rumen ecosystem as reported by [23] that showed enzyme cocktail produced by a fungal strain from South African soil improving lamb performance when used as a feed additive. However, this product showed limited potential in low forage diet. The better dry matter (DM) digestibility by producing fibrolytic enzymes may favor the growth of all fibrolytic microbiota [24] and increased production of volatile fatty acids in the rumen [25]. In dairy cow diets, the supplementation with fibrolytic enzymes from T. longibrachiatum may increase the population of rumen bacteria that utilize hemicelluloses and secondary products of cellulose digestion [26].
In another study, similar results were observed with the addition of commercial fibrolytic enzymes derived from Trichoderma longibrachiatum in lambs fed with Cenchrus ciliaris L. hay (300 g/kg DM). The authors observed increase of 8.80% in ADG and 12.6% in total weight gain for the group supplemented with these enzymes. This improvement resulted from better digestibility of the dry matter, NDF and ADF of hay, without significant effects on DMI [4].
The addition of xylanase and glucanase derived from Aspergillus spp. and Trichoderma spp. for goats fed rice straw (300 g/kg DM), resulted in improvement of fiber digestibility, providing substrates for growth and metabolism of rumen bacteria. These enzymes promoted a 34.70% increase in ADG without changes in DMI [8].
In another study evaluating buffalo performance, the addition of xylanase and cellulase derived from Trichoderma reesei, in the diet containing Avena sativa (50%) silage, resulted in significantly increase of DWG and FC without changes for DMI [27]. In calves, the increase in 15.37% of ADG with addition of the anaerobic fungus Orpinomyces sp. also was not related to increment in DMI in diets containing 50% of rice straw [28].
Changes in DMI were also not observed with the addition of enzymes derived from Aspergillus niger, Trichoderma longibrachiatum in diets (40 % voluminous) of cows [5] Mohamed et al., 2013), and for cows supplemented with enzymes derived from Trichoderma reesei and fed with 60% of voluminous [29]. The supplementation with enzymatic mixture produced by Aspergillus awamori in sheep fed with 50% of seed promoted a significant increase for ADG without significant changes in DMI [3], which was also found in the present study.
The low quality of the roughage as the used in this study is an important factor influencing the food passage rate in the rumen and the stimulus to intake. These factors may directly interfere with the effects of microbial additives on ruminal degradation and food passage rate [30,4]. In this research, high levels of NDF (82.26%), ADF (53.04%) and lignin (7.50%) of U. decumbens hay, used as an only roughage may have resulted in a longer stay period of its fiber in the rumen.
In contrast to that observed in this study, a study indicated a significant increase in DMI by the addition of 1 and 3 μl/g of dry matter of the commercial(xylanase in lambs fed with corn straw (30% in DM) [6]. In another research, an increase of 11% in DMI was observed in goats fed with corn straw (8% in DM), alfalfa hay (32% in DM) and supplemented with commercial cellulase [31]. However, the addition of increasing amounts of T. longibrachiatum enzyme complex in the diet of sheep fed with barley (62.9% in DM) promoted a quadratic response in DMI without significant changes to ADG [32].
In the present study, we used a (70:30) concentrate: voluminous ratio and even so it was observed an increase in ADG with the inclusion of the fungal strain in the supplementation of lambs. The dietary fiber content may also directly influence the action of fibrolytic enzymes or fungal cells in the ruminal environment [27]. Differently from that observed in this research, when using diet with 70 % of concentrate in DM, no significant increase was observed in ADG and DMI with the addition of cellulase produced by the fungus Trichoderma spp. in sheep [33]. However, high fiber diets in animals supplemented with enzymatic coquetel from the ABO 374 strain soil isolate resulted in a significant reduction in ADG, DMI and FC [23].
These divergent results among these studies could be related on the chemical and structural composition of the voluminous, the concentration of the form of microbial additive and the different ratios of concentrate: voluminous. These may represent important factors in the action of the fungi additives and in the composition of the ruminal ecosystem and, therefore, should be considered in future researches.
Economic profitable
The improvement of the productive indicators and the food efficiency result in the better economic efficiency. The increase in ADG for lambs fed with the fungi strain resulted in a reduction in 13.35% for cost/kg of BW produced and, therefore, provided higher gross and net profits with commercialization of the animals (Table 3).
Although significant differences for DMI, FC and FE between the lambs groups were not detected (Table 2), the animals supplemented with the fungal strain presented numerically higher DMI values, which may have promoted a small increase in cost of diet (Table 3). However, the addition of the fungal strain resulted in the improved economic profitable expressed in NP (Table 3). Further larger-scale studies and using other fungal additive inclusion strategies would determine better economic gains.
Few studies have reported the economic profitable of adding fungal strains and their enzymes to the diet of lambs. In the research that evaluated the diet containing seeds of crushed date pits supplemented with enzymes produced by Aspergillus awamori in substitution of barley in the diet of sheep, no differences were observed in the relative economic efficiency with the addition of up to 50% of the seed of date (99.73%) in relation to the control group (100%). However, a 14.25% reduction in cost/kg of body weight was observed [3], which was similar to that observed in this present study (13.35%).
Conclusion
Administration of autochthonous fungal strain ICA/UFMG LT 001 promotes better average daily gain of weaned lambs fed with low quality hay up to 42 days of feedlot. In addition, the use of this fungal strain results in a better economic profitable of the supplementation of weaned lambs.
Acknowledgments
This work was funded by Coordenação de Aperfeiçoamento de Pessoal de Ensino Superior (CAPES- funde 0001), Conselho Nacional de Desenvolvimento Cientifico e Tecnológico (CNPq 308204/2015-8), Fundação de Amparo à Pesquisa do Estado de Minas Gerias (FAPEMIG, PPM-00393-17), and Pro-reitoria de Pesquisa and Pós-graduação da Universidade Federal de Minas Gerais.
REFERENCES
1. Franco MO, Detemann E, Filho SCV, Batista ED, Rufino LMA, Barbosa MM, et al. Intake, digestibility, and rumen and metabolic characteristics of cattle fed low-quality tropical forage and supplements with nitrogen and different levels of starch. Asian-Australian Journal of Animal Science. 2017; 30: 797-803.
2. Raineri C, Stivari TSS and Gameiro AH. Lamb production costs: analyses of composition and elasticities analysis of lamb production Costs. Asian-Australian Journal of Animal Science. 2015; 28:1209 1215.
3. Abdelrahman M, Sami A, Suliman G and Abudabos A. Growth performance and economic efficiency of fattening Naimi lambs on unconventional ration enhanced with enzyme cocktail. Pakistan Journal of Agricultural Sciences. 2016; 53:467-471.
4. López-Aguirre D, Hernández-Meléndez J, Rojo R, Sánchez-Dávila F, López-Villalobos N et al. Effects of exogenous enzymes and application method on nutrient intake, digestibility and growth performance of Pelibuey lambs. Springer Plus. 2016; 1399:1-6.
5. Mohamed DEDA, Borhami BE, El-Shazly KA and Sallam SMA. Effect of dietary supplementation with fibrolytic enzymes on the productive performance of early lactating dairy cows. Journal of Agricultural Science. 2016; 5:146-155.
6. Vallejo LH, Salem AZM, Camacho LM, Kholif AM, Mariezcurrena MD, Cipriano M et al. Effects of xylanase supplementation on feed intake, digestibility and ruminal fermentation in Rambouillet sheep. Journal of Agricultural Science. 2016; 154:1110-1117.
7. Adesogan AT, Ma ZX, Romero JJ and Arriola KG. Improving cell wall digestion and animal performance with fibrolytic enzymes. Journal of Animal Science. 2014; 92:1317-1330.
8. Yuangklang C, Schonewille JTh, Alhaidary A, Vasupen K, Bureenok S, Seanmahayak B et al. Growth performance and macronutrient digestion in goats fed a rice straw based ration supplemented with fibrolytic enzymes. Small Ruminant Research. 2017; 154:20-22.
9. Abrão FO, Duarte ER, Freitas CES, Edvaldo AV, Gerassev LC, Hughes AFS et al. Characterization of fungi from ruminal fluid of beef cattle with different ages and raised in tropical lignified pastures. Current Microbiology. 2014; 69: 649-659.
10. Abrão FO, Duarte ER, Pessoa MS, Dos Santos VL, Freitas Júnior LF, Barros KO et al. Notable fibrolytic enzyme production by Aspergillus spp. isolates from the gastrointestinal tract of beef cattle fed in lignified pastures. Plos ONE. 2017; 12: 1-13.
11. Solomon KV, Haitjema CH, Henske JK, Gilmore SP, Borges-Rivera D, Lipzen A et al. Early-branching gut fungi possess a large, comprehensive array of biomass-degrading enzymes. Science. 2016; 351: 1192-1195.
12. Freitas CES, Abrão FO, Silva KL, Almeida PNM and Duarte ER. Fungos aeróbios no intestino grosso de borregos e de ovelhas criados em pastagens tropicais. Arquivo Brasileiro de Medicina Veterinária e Zootecnia. 2012; 64: 225-227.
13. Alvares CA, Stape JL, Sentelhas PC, Gonçalves JLM and Sparovek G. Köppen’s climate classification map for Brazil. Meteorologische Zeitschrift. 2014; 22: 711-728.
14. AOAC. Association of Official Analytical Chemists. Official Methods of Analysis, 19th edition. Gaithersburg, 2010
15. NRC. National Research Council. Nutrient requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids, 7th edition. National Academy Press, Washington, DC, USA, 2007.
16. Rosa LH, Vaz ABM, Caligiorne RB, Campolina S and Rosa CA. Endophytic fungi associated with the Antarctic grass Deschampsia antarctica Desv (Poaceae). Polar Biolology, 2009; 32: 161-167.
17. White TJ, Bruns T, Lee S and Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (eds) PCR protocols, a guide to methods and applications. Academic Press San Diego. 1990: 315-322
18. Altschul SF, Madden TL, Schaffer AA, Zheng Zhang JZ, Miller W and Lipman DJ. Gapped BLAST and PSI-BLAST, a new generation of protein database search programs. Nucleic Acid Research. 1997; 25: 3389-402.
19. Gerassev LC, Moreira SJM, Alves DD, Aguiar ACR, Monção FP, Dos Santos ACR et al. Viabilidade econômica da utilização dos resíduos da bananicultura na alimentação de cordeiros confinados. Revista Brasileira de Saúde e Produção Animal. 2013; 14: 734-744.
20. Li C, Lin F, Li Y, Wei W, Wang H, Qin L et al. A β-glucosidase hyper production Trichoderma reesei mutant reveals a potential role of cel3D in cellulase production. Microbial Cell Factories. 2016; 15:1-13.
21. Schuster A and Schmoll M. Biology and biotechology of Trichoderma. Applied Microbiology and Biotechnology. 2010; 87: 787-799.
22. Toth K, Van Gool MP, Schols HA, Samuels GJ, Gruppen H and Szakaes G. Diversity in production of xylan degrading enzymes among species belonging to the Trichoderma Section Longibrachiatum. Bioenergy Research. 2013; 6: 631-643.
23. Cruywagen CW and Van Zyl WH. Effects of a fungal enzyme cocktail treatment of high and low forage diets on lamb growth. Animal Feed Science and Technology. 2008; 145, 151-158.
24. Morgavi DP, Beauchemin KA, Nsereko VL, Rode LM, Iwaasa AD, Yang WZ et al. Synergy between ruminal fibrolytic enzymes and enzymes from Trichoderma longibrachiatum. Journal of Dairy Science. 2000; 83: 1310-1321.
25. Díaz A, Ranilla MJ, Giraldo LA, Tejido ML and Carro MD 2014. Treatment of tropical forages with exogenous fibrolytic enzymes: effects on chemical composition and in vitro rumen fermentation. Journal of Animal Physiology and Animal Nutrition 99, 345-355.
26. Nsereko VL, Beauchemin KA, Morgavi DP, Rode LM, Furtado AF, McAllister TA et al. Effect of a fibrolytic enzyme preparation from Trichoderma longibrachiatum on the rumen microbial population of dairy cows. Canadian Journal of Microbiology. 2002; 48: 14-20.
27. Nawaz H, Shahzad N, Saif-ur-Rehman M and Ali M. Effect of feeding xylanase and cellulose treated oat silage on nutrient digestibility, growth performance and blood metabolites of Nili Ravi buffalo calves. Pakistan Journal of Agricultural Sciences. 2016; 53: 999-1004.
28. Dey A, Sehgal JP, Puniya AK and Singh K. Influence of an anaerobic fungal culture (Orpinomyces sp.) administration on growth rate, ruminal fermentation and nutrient digestion in calves. Asian Australian Journal of Animal Science. 2004; 17: 820-824.
29. Peters A, Meyer U and Dänicke S. Effect of exogenous fibrolytic enzymes on performance and blood profile in early and mid-lactation Holstein cows. Animal Nutrition. 2015; 1: 229-238.
30. Martins AS, Vieira PF, Berchielli TT, Prado IN, Lempp B and Paula MC 2007. Degradabilidade in situ e observações microscópicas de volumosos em bovinos suplementados com enzimas fibrolíticas exógenas. Revista Brasileira de Zootecnia 36, 1927-1936.
31. Rojo R, Kholif AM, Salem AZM, Elghandour MMY, Odongo NE, Montes de Oca R et al. Influence of cellulase addition to dairy goat diets on digestion and fermentation, milk production and fatty acid content. Journal of Agricultural Science. 2015; 153: 1514-1523.
32. Miller DR, Elliott R and Norton BW. Effects of an exogenous enzyme, Roxazyme® G2 Liquid, on digestion and utilization of barley and sorghum grain-based diets by ewe lambs. Animal Feed Science and Technology. 2008; 140: 90-109.
33. Muwalla MM, Haddad SG and Hijazeen MA. Effect of fibrolytic enzyme inclusion in high concentrate fattening diets on nutrient digestibility and growth performance of Awassi lambs. Livestock Science. 2007; 111: 255-258.