Submit Article
Back to Journal

Annals of Applied Microbiology & Biotechnology Journal

Mycoplasma leachii Causes Bovine Mastitis: Evidence from Clinical Symptoms, Histopathology and Immunohistochemistry

[ ISSN : 2576-5426 ]

Abstract Introduction Materials and Methods Results Discussion Acknowledgements References
Details

Received: 26-Sep-2017

Accepted: 06-Oct-2017

Published: 12-Oct-2017

Research Article | Volume 1 - Issue 1 | Article DOI : 10.36876/aamb.1003

Download PDF

Jitao Chang1, Debin Yu2, Jianbin Liang2, Jia Chen2, Fang Wang1, Zhigang Jiang1,
Xijun He3, Rui Wu2* and Li Yu1*

1Division of Livestock Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, P.R. China
2College of Animal Science and Veterinary Medicine, Heilongjiang Bayi Agricultural University, P.R. China
3Pathology Laboratory, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, P.R. China

Corresponding Author:

Li Yu, Professor, Division of Livestock Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, 427 Maduan Street, Harbin 150001, P.R. China, Tel: +86-451-51051738; Fax: +86-451-51997166;

 

Rui Wu, College of Animal Science and
Veterinary Medicine, Heilongjiang Bayi
Agricultural University, Daqing High-tech
Industrial Development Zone, Daqing,
163319, P.R. China,
Tel: + 86-4596819191;

Keywords

M. leachii; Bovine mastitis; Pathogenicity

Abstract

Twelve quarters of six lactating cows were inoculated with Mycoplasma leachii strain GN407 through intramammary ductal infusion, and another twelve quarters were inoculated with Mycoplasma culture medium as controls. One lactating cow was used as negative control, in which two quarters were inoculated with Mycoplasma culture medium, and another two quarters were not inoculated with any medium. Clinical observations, histopathology and Immunohistochemistry (IHC) detection were performed on Post Inoculation Days (PIDs) 3, 6 and 9 to elucidate the pathogenicity of M. leachii in bovine mastitis. From PIDs 3 to 9, twelve inoculated quarters developed mild to severe clinical mastitis and mammary tissue histopathological changes, including inflammatory cell infiltration and architectural destruction of mammary gland ducts; on PID 9, the control quarters also developed mild mastitis and histopathological changes. Throughout the experimental period, the quarters of the negative control cow were clinically and pathologically normal. The M. leachii antigen was detected by IHC in the mammary tissues of the inoculated quarters as a weak signal on PID 6 and as a strong signal on PID 9; on PID 9, the M. leachii IHC signal was also detected in mammary gland epithelial cells of the control quarters of the inoculated cattle. The M. leachii antigen was not detected in the mammary tissues from the quarters of the negative control cow on PID 9. In conclusion, direct histological and immunohistochemical evidence confirmed that M. leachii causes clinical bovine mastitis through histopathological lesions induced by the invasion of the pathogen into mammary gland cells and inflammatory cell infiltration

Introduction

Bovine mastitis is one of the costliest diseases affecting dairy farming, and its losses are calculated based on reduced milk production, discarded milk, increased cull rate, pharmacologic costs and increased labor. Many microbial species, such as Escherichia coli, Klebsiella pneumoniae, Streptococcus agalactiae and Staphylococcus aureus, are common causes of bovine mastitis [1]. Mycoplasma spp. are also pathogens associated with bovine mastitis [2,3]. Mycoplasma-induced mastitis was first reported in England by Davidson and Stuart [4] and has since been reported on all continents. Mycoplasma bovis is the most prevalent Mycoplasma species causing bovine mastitis [3,5]. Additionally, Mycoplasma leachii (M. leachii), a new species designation for Mycoplasma sp. bovine group 7 [6], has been isolated from milk samples obtained from cows with mastitis [7-9], and its mild clinical mastitis phenotype was reproduced by infusing M. leachii cultures into one quarter of a lactating cow [7], suggesting that M. leachii is a new possible cause of bovine mastitis. However, direct histopathological and immunohistochemical evidence was not presented in the previous pathogenicity study of M. leachii [7]; therefore, M.leachii has not been proven to be the direct cause of the mild mastitis previously observed in a cow [7]. Since there is insufficient evidence for an association between M.leachii infection and bovine mastitis, additional inoculated cows and direct histopathological and immunohistochemical detection should be performed to determine the pathogenicity of M. leachii in bovine mastitis.

Materials and Methods

Ethics statement

The animal experiments in this study were reviewed and approved by the Animal Care and Use Committee of the Harbin Veterinary Research Institute (HVRI) of the Chinese Academy of Agricultural Sciences (CAAS) on 2 November 2015 (approval number SQ2015112). All animals were housed and cared for in an accredited facility at the HVRI in accordance with local and institutional policies.

Mycoplasma strain and culture production

M. leachii strain GN407, which was originally isolated from the joint fluid of arthritic calves in Heilongjiang Province of China in 2010, was passaged 4 times before triple plaque purification. The final titer was 1 × 108 color-changing units per milliliter (CCU/ml). In lppA gene sequence analyses, the GN407 strain shared 99.6%, 95.1%, and 69.6% nt identity to M. leachii representative strain PG50, M. mycoides subsp. mycoides small colony type, and M. capricolum subsp. capricolum, respectively [10,11].

Animals and experimental inoculation

Seven lactating Holstein breed cows without subclinical mastitis in the current lactation and with no antibodies against M. leachii were selected for inoculation with M. leachii GN407 [11] cultures to evaluate the pathogenicity of M. leachii in bovine mastitis. The California Mastitis Test (CMT) was used to detect subclinical mastitis in cows. ELISA and western blot using expressed LPPA protein as an antigen were performed to detect antibodies against M. leachii; the LPPA protein was prepared by Wang Guanbo and co-workers in our laboratory (unpublished data). Twelve quarters of six lactating cows (left fore and hind quarters of each cow) were inoculated with 5 ml of fresh culture containing 1 × 108 CCU/ml of M. leachii strain GN407 through intramammary ductal infusion, and another twelve quarters (right fore and hind quarters of each cow) were inoculated with Mycoplasma culture medium (Becton, Dickinson and Companay Sparks, MD 21152 USA) as a control. As a negative control animal, two quarters of one lactating cow (left fore and hind quarters) were inoculated with 5 ml of Mycoplasma culture medium, and another two quarters (right fore and hind quarters) were not inoculated with any medium (Table 1). 

Table 1: Inoculation of lactating cows with passage cultures of M. leachii strain GN407 via the intramammary route and detection of pathogens in mammary samples from the inoculated cows.

Cow No. Inoculated Inoculums Inoculation route Post inoculation Ma mmary samples  
quarter day (PID) Clinical findings Histopathology IHC
  left fore 5 ml of M. leachii GN407 culture, 1×108 CCU/ml     + + -
  left hind     + + -
3 right fore       - - -
  right hind 5 ml of culture medium     - - -
  left fore 5 ml of M. leachii GN407 culture, 1×108 CCU/ml     + + -
  left hind     + + -
4 right fore     3 - - -
  right hind 5 ml of culture medium     - - -
  left fore 5 ml of M. leachii GN407 culture, 1×108 CCU/ml     ++ ++ +
  left hind     ++ ++ +
2 right fore       - - -
  right hind 5 ml of culture medium     - - -
  left fore 5 ml of M. leachii GN407 culture, 1×108 CCU/ml     ++ ++ +
  left hind     ++ ++ +
5 right fore     6 - - -
  right hind 5 ml of culture medium     - - -
  left fore 5 ml of M. leachii GN407 culture, 1×108 CCU/ml     +++ +++ +++
  left hind     +++ +++ +++
1 right fore       + + ++
  right hind 5 ml of culture medium     + + ++
  left fore 5 ml of M. leachii GN407 culture, 1×108 CCU/ml     +++ +++ +++
  left hind     +++ +++ +++
6 right fore       + + ++
  right hind 5 ml of culture medium Intramammary   + + ++
  left fore       - - -
  left hind 5 ml of culture medium   9 - - -
7 right fore       - - -
  right hind no inoculation     - - -

‘‘-” Negative for detection using the corresponding assay.

‘‘+’’ Positive for detection using the corresponding assay; “+” mildly or weakly positive;

“++” moderately positive; “+++” severely or strongly positive.

Necropsy and sampling

On post inoculation days (PIDs) 3, 6 and 9, milk samples were collected from all inoculated cows for PCR detection and cultural isolation of M. leachii. The samples were simultaneously plated on Columbia agar (Oxoid, Basingstoke, UK) with 5% sheep blood and incubated at 37°C in 5% CO2 for isolation of other bacteria. Cows No. 3 and 4, 2 and 5, and 1, 6 and 7 were euthanized on PIDs 3, 6 and 9, respectively, and subjected to necropsy. Mammary gland tissue samples were collected and fixed in 4% neutral-buffered formalin for histopathology and Immunohistochemistry (IHC) assays.

Histopathology

The formalin-fixed tissues were embedded in paraffin wax, sliced to a thickness of 4 µm and stained with Hematoxylin and Eosin (H&E) for histological examination. Analyses were subsequently performed by the Pathology Laboratory of Animal Infectious Disease Diagnostic Centre, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

PCR

According to a previously described method [12], the specific primer pair P67BG7-L:GGTAATTCGAATAATGATCCT/P67BG7-R:TAAGTTTATTGAAT-TAAAGCG was used for PCR amplification of the lppA gene with an annealing temperature of 55°C to detect M. leachii in samples.

Immunohistochemistry (IHC)

Monoclonal antibody (mAb) 1F2, which was prepared by Wang Guanbo and co-workers in our laboratory (unpublished data), was used for IHC detection. The isotype of 1F2 is of the IgG1/κ-type subclass. Western blot showed that mAb 1F2 specifically bound to M. leachii GN407 but not to other Mycoplasma species (such as Mycoplasma bovis, Mycoplasma mycoides subsp. capricolum, Mycoplasma ovipneumoniae, Mycoplasma. mycoides subsp. Mycoides small colony type, or Mycoplasma capricolum subsp. capripneumoniae), and the titer of this antibody was 1:105 based on ELISA detection. For all immunohistochemical reactions, the Avidin: Biotinylated enzyme Complex (ABC) method was applied. We used formalin-fixed samples, mAb 1F2 and normal mouse (BALB/c) serum as a negative control. Subsequent work was performed by the Pathology Laboratory of Animal Infectious Disease Diagnostic Centre of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

Results

Clinical manifestations of the quarters of all M. leachii inoculated cows were observed throughout the experimental period. Histopathology and IHC detection of the mammary tissues were performed on PIDs 3, 6 and 9. The clinical signs and histopathology of the M. leachii-inoculated quarters exhibited a gradual progression to severe mastitis over the 9-day experimental period (Table 1, Figure 1),

Figure 1: Histopathology of mammary tissue samples from M. leachii-inoculated cows.

and the M. leachii antigen was detected in mammary tissue from the inoculated quarters of the affected cows on PIDs 6 and 9 by IHC (Table 1, Figure 2).

Figure 2: IHC assay for the M. leachii antigen in mammary tissue samples from M. leachii-inoculated cows.

For the control quarters of the M. leachii-inoculated cows, they were histopathologically and immunohistochemically negative on PIDs 3 and 6 but they developed mild mastitis and histopathological changes on PID 9, and the M. leachii IHC signal was also detected in mammary gland epithelial cells of these control quarters (Table 1, Figures 1 and 2). Throughout the experimental period, however, the quarters of the negative control cow were clinically and histopathologically normal, and the M. leachii antigen was not detected in the mammary tissues of the control cow on PID 9 (Table 1, Figures 1 and 2). The clinical signs of the affected mammary glands were swelling and firmness, the produced milk was yellow and contained large ropy clots, and the milk yield of the inoculated quarters was markedly decreased. These results, particularly the detection of the M. leachii antigen in the mammary gland epithelial cells of the inoculated cows, indicated that the mammary gland lesions were directly caused by M. leachii.

On PID 3, all twelve M. leachii-inoculated quarters of the six experimental cows (Nos. 1-6) developed mild clinical mastitis, whereas the twelve control quarters of the six inoculated cows were normal. Cows 3 and 4 were euthanized on PID 3 and subjected to necropsy. Histopathological changes, primarily Neutrophilic granulocyte infiltration, were observed in the mammary tissues from all four inoculated quarters (Table 1, Figure 1), but the M. leachii antigen was not detected (Table 1, Figure 2). Histopathological changes and the M. leachii antigen were not detected in the mammary epithelial cells and mammary ducts of the control quarters of cows 3 and 4 (Table 1, Figures 1 and 2), indicating that M. leachii did not invade mammary cells during the early stage of mastitis.

On PID 6, the eight inoculated quarters of the remaining four experimental cows (Nos. 1, 2, 5 and 6) exhibited moderate clinical mastitis, and all eight control quarters remained normal. Cows 2 and 5 were necropsied on PID 6, and the histopathological examination of the four inoculated quarters showed moderate and diffuse neutrophilic granulocyte infiltration (Table 1, Figure 1) and mild destruction of some mammary gland duct structures in the left fore quarter of cow No. 5 (Figure 1). At this time, the M. leachii antigen was detected as a weak signal in the mammary epithelial cells of the four inoculated quarters from cows 2 and 5 (Table 1, Figure 2), but histopathological changes and the M. leachii antigen were still not detected in any of the four control quarters of cows 2 and 5 (Table 1, Figures 1 and 2). Thus, M. leachii invaded the mammary epithelial cells in the inoculated quarters by PID 6, but it did not spread to the opposite control quarters in the inoculated bodies at that time.

On PID 9, severe clinical mastitis was observed in the four inoculated quarters of the remaining two experimental cows (Nos. 1 and 6). Importantly, all four control quarters of cows 1 and 6 had also developed mild mastitis (Table 1) at that time. Cows 1 and 6 were necropsied for a histopathological examination, and more extensive and severe Neutrophilic infiltration and destruction of the mammary gland ducts were observed in all four inoculated quarters (Table 1, Figure 1). Additionally, necrosis of mammary epithelial cells was observed in the mammary gland tissue from the left hind quarter of cow No. 6 (Figure 1). The M. leachii antigen was detected as a strong signal in mammary epithelial cells of the four inoculated quarters of cows 1 and 6 (Table 1, Figure 2). In addition, mild histopathological changes were observed (Table 1, Figure 1) and the M. leachii antigen was detected (Table 1, Figure 2) in all four control quarters of cows 1 and 6 on PID 9. Thus, M. leachii propagated abundantly in the mammary epithelial cells of the inoculated quarters on PID 9. Importantly, the pathogen had invaded the adjacent quarter on the opposite side at that time.

On PIDs 3, 6 and 9, the M. leachii signal detected via PCR in the milk samples from the infected quarters ranged from weak to strong, and the M. leachii titer also gradually increased (Table 2). The PCR detection and isolation of M. leachii from the milk samples of the control quarters was negative on PIDs 3 and 6; however on PID 9, a moderately positive PCR signal was detected in the milk samples of the control quarters of the experimental cows, and M. leachii was also isolated (Table 2). These M. leachii PCR detection and isolation results were consistent with the clinical, histopathological and immunohistochemical results. Additionally, no pathogenic bacteria were isolated and identified from the milk samples of the infected cows, indicating the absence of bacterial coinfection in the mammary gland tissue.

Table 2: PCR detection and isolation of M. leachii from milk samples of the inoculated cows.

    3 6 9
Cow No. Inoculated quarter M. leachii PCR M. leachii isolation M. leachii PCR M. leachii isolation M. leachii PCR M. leachii
    isolation
  left fore + 1×104 NP NP NP NP
  CCU/ml
  left hind + 1×104 CCU/ml NP NP NP NP
3 right fore — — NP NP NP NP
  right hind — — NP NP NP NP
  left fore + 1×104 CCU/ml NP NP NP NP
  left hind + 1×104 CCU/ml NP NP NP NP
  right fore — — NP NP NP NP
4 right hind — — NP NP NP NP
  left fore + 1×104 ++ 1×106 CCU/ml NP NP
  CCU/ml
  left hind + 1×104 CCU/ml ++ 1×106 CCU/ml NP NP
2 right fore — — — — NP NP
  right hind — — — — NP NP
  left fore + 1×104 CCU/ml ++ 1×106 CCU/ml NP NP
  left hind + 1×104 CCU/ml ++ 1×106 CCU/ml NP NP
  right fore — — — — NP NP
5 right hind — — — — NP NP
  left fore + 1×104 ++ 1×106 CCU/ml ++++ 1×108 CCU/ml
  CCU/ml
  left hind + 1×104 CCU/ml ++ 1×106 CCU/ml ++++ 1×108 CCU/ml
1 right fore — — — — ++ 1×106 CCU/ml
  right hind — — — — ++ 1×106 CCU/ml
  left fore + 1×104 ++ 1×106 CCU/ml ++++ 1×108 CCU/ml
  CCU/ml
  left hind + 1×104 CCU/ml ++ 1×106 CCU/ml ++++ 1×108 CCU/ml
6 right fore — — — — ++ 1×106 CCU/ml
  right hind — — — — ++ 1×106 CCU/ml
  left fore — — — — — —
  left hind — — — — — —
  right fore — — — — — —
7 right hind — — — — — —

Discussion

Bovine mastitis, causing the decrease in milk production, increased health care costs and increased culling and death rates [13], is responsible for major economic losses on dairy farms worldwide. Moreover, mastitis poses a threat to human health since it may be responsible for zoonoses and food toxin infections [14,15]. Mastitis caused by mycoplasmas is less common than mastitis caused by other bacteria, but it results in severe udder disease [16] and can usually be differentiated from mastitis caused by other bacteria because it exhibits the following features: (1) it is highly contagious; (2) it affects more than one quarter; (3) it causes a significant loss in milk production; (4) it is often refractory to antibiotic treatment; (5) it may result in increased purulence; and (6) affected cows can remain externally normal, with few overt clinical signs, even in severe cases. For these reasons, mycoplasma mastitis is considered untreatable; consequently, culling remains the most common recommendation for its control [3]. Of the approximately 25 mycoplasmas that have been detected in cattle, only a few have been linked to bovine mastitis. Mycoplasma bovis is most prevalent and was first isolated from mastitic cows in 1961 [3]. Other species that have been reported as causes of mycoplasma mastitis include Mycoplasma arginini and M. leachii [3,17].

M. leachii was initially isolated from the joint fluid of arthritic calves in southern Queensland, Australia in 1963 [18]. Subsequently, M. leachii was also isolated from calves with polyarthritis and pneumonia, cows with signs of mastitis, aborted fetuses and small ruminant hosts [7-9,19-21]. In China, polyarthritis in calves caused by M. leachii was an emerging disease in 2009, and M. leachii strain GN407 was first isolated from the joint fluid of arthritic calves in China by our laboratory [10,11]. M. leachii was isolated from milk samples obtained from cows with mastitis [7-9], and its mild clinical mastitis phenotype was reproduced by infusing M. leachii cultures into one quarter of a lactating cow [7]. However, the histopathological and immunohistochemical evidence was insufficient to support the pathogen-disease relationship. In this study, we demonstrated that M. leachii directly causes clinical bovine mastitis using histopathological and immunohistochemical methods, and we further confirmed that M. leachii is one of the causes of bovine mastitis. Because numerous pathogens are responsible for bovine mastitis, with the majority of infections caused by staphylococci, streptococci and enterobacteria, milk samples collected both pre- and post inoculation were plated on Columbia agar for the isolation and identification of other main pathogenic bacteria. No pathogenic bacteria were isolated and identified from the milk samples of the infected cows, indicating the absence of bacterial coinfection in the mammary gland tissue of the experimental cows. Although no other pathogens, including bacteria and viruses, were detected, the histopathological and immunohistochemical evidence from this study is sufficient to support the conclusion that M. leachii can directly cause bovine mastitis.

As mentioned above, bovine mastitis caused by mycoplasmas has unique characteristics, including that it often affects more than one quarter. In this study, M. leachii also invaded the adjacent quarter on the opposite side of the inoculated quarters at a later stage of mastitis, indicating that M. leachii can spread from the inoculated quarter to the opposite adjacent quarter in the same cow’s body. This result is consistent with the characteristic of Mycoplasma mastitis affecting more than one quarter. However, the route of transmission of M. leachii in the body is currently unclear. It has been reported that Mycoplasma spp. can spread from one bovine body site to another, presumably via the lymph or peripheral blood system [22-24].

During the 9-day experimental period, the histopathology of all inoculated quarters showed a gradual progression to severe mastitis (Table 1, Figure 1). On PID 3, histopathological changes were observed in the mammary tissues from all four inoculated quarters, but the M. leachii antigen signal was not detected (Table 1, Figure 1). The mechanism underlying this inconsistency is unclear and may be related to mammary immunobiology. The mammary gland immune system consists of a diverse array of physical, cellular, and molecular factors that function in the innate or acquired immune responses. Components of the innate defense system include nonspecific physical barriers of the teat end, pattern recognition receptors, phagocytes (i.e., neutrophils and macrophages), and various soluble factors (i.e., cytokines, complement, and lactoferrin) [25]. In this study, the histological changes observed in the inoculated quarters on PID 3 consisted of neutrophilic granulocyte infiltration, but the M. leachii antigen was not detected. Therefore, the inflammation observed on PID 3 is suggested to be caused by the extracellular propagation of M. leachii in mammary ducts. Some M. leachii may be phagocytosed and eliminated by inflammatory cells, whereas a small amount of residual M. leachii that had colonized the lumen of the mammary ducts had not yet invaded the mammary epithelial cells in the early stage of mastitis. Thus, although histological changes (Neutrophilic granulocyte infiltration) were observed in the inoculated quarters on PID 3, the M. leachii antigen was not detected in the mammary epithelial cells or mammary ducts.

In summary, the pathogenicity of M. leachii in bovine mastitis was investigated using an artificial infection experiment. Direct histological and immunohistochemical evidence confirmed that M. leachii causes clinical mastitis in cows, which results from histopathological lesions induced by the invasion of the pathogen into mammary gland cells and inflammatory cell infiltration. Moreover, M. leachii can spread from the inoculated quarter to the opposite adjacent quarter in the body.

Acknowledgements

This study was supported by the Natural Science Fund Project of Heilongjiang Province of China (C201348), the Key Technologies R & D Program of Heilongjiang Province of China (GA12B301), and the National Science and Technology Program Topics of China (2012BAD12B03-3).

References

1. Zadoks RN, Middleton JR, McDougall S, Katholm J, Schukken YH. Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans. J Mammary Gland Biol Neoplasia. 2011; 16: 357-372.

2. Maunsell FP, Woolums AR, Francoz D, Rosenbusch RF, Step DL, Wilson DJ. Mycoplasma bovis infections in cattle. J Vet Intern Med. 2011; 25: 772-783.

3. Nicholas RA, Fox LK, Lysnyansky I. Mycoplasma mastitis in cattle: To cull or not to cull. Vet J. 2016; 216: 142-147.

4. Davidson I, Stuart P. Isolation of a mycoplasma-like organism from an outbreak of bovine mastitis. Vet Rec. 1960; 72: 766.

5. Nicholas RA, Ayling RD. Mycoplasma bovis: disease, diagnosis, and control. Res Vet Sci. 2003; 74: 105-112.

6. Manso-Silván L, Vilei EM, Sachse K, Djordjevic SP, Thiaucourt F, Frey J Mycoplasma leachii sp. nov. as a new species designation for Mycoplasma sp. bovine group 7 of Leach, and reclassification of Mycoplasma mycoides subsp. mycoides LC as a serovar of Mycoplasma mycoides subsp. capri. Int J Syst Evol Microbiol. 2009; 59: 1353-1358.

7. Connole MD, Laws L, Hart RK. Mastitis in cattle caused by a Mycoplasma sp. Aust Vet J. 1967; 43: 157-162.

8. Alexander PG, Slee KJ, McOrist S, Ireland L, Coloe PJ. Mastitis in cows and polyarthritis and pneumonia in calves caused by Mycoplasma species bovine group 7. Aust Vet J. 1985; 62: 135-136.

9. Hum S, Kessell A, Djordjevic S, Rheinberger R, Hornitzky M, Forbes W, et al. Mastitis, polyarthritis and abortion caused by Mycoplasma species bovine group 7 in dairy cattle. Aust Vet J. 2000; 78: 744-750.

10. Liu H, Chang J, Yu L. Polyarthritis in calves caused by Mycoplasma leachii sp. nov in China. Chinese Journal of Preventive Veterinary Medicine. 2010; 32: 415-418.

11. Chang JT, Liu HJ, Yu L. Mycoplasma leachii sp. nov. in calves, China. Emerg Infect Dis. 2011; 17: 1772-1773.

12. Frey J, Cheng X, Monnerat MP, Abdo EM, Krawinkler M, Bölske G, et al. Genetic and serological analysis of the immunogenic 67-kDa lipoprotein of Mycoplasma sp. bovine group 7. Res Microbiol. 1998; 149: 55-64.

13. Gomes F, Saavedra MJ, Henriques M. Bovine mastitis disease/pathogenicity: evidence of the potential role of microbial biofilms. Pathog Dis. 2016; 74.

14. Blum S, Heller ED, Krifucks O, Sela S, Hammer-Muntz O, Leitner G. Identification of a bovine mastitis Escherichia coli subset. Vet Microbiol. 2008; 132: 135-148.

15. Fernandes JB, Zanardo LG, Galvão NN, Carvalho IA, Nero LA, Moreira MA. Escherichia coli from clinical mastitis: serotypes and virulence factors. J Vet Diagn Invest. 2011; 23: 1146-1152.

16. Fox LK, Muller FJ, Wedam ML, Schneider CS, Biddle MK. Clinical Mycoplasma bovis mastitis in prepubertal heifers on 2 dairy herds. Can Vet J. 2008; 49: 1110-1112.

17. González RN, Wilson DJ. Mycoplasmal mastitis in dairy herds. Vet Clin North Am Food Anim Pract. 2003; 19: 199-221.

18. Simmons GC, Johnston LA. Arthritis in calves caused by Mycoplasma sp. Australian Veterinary Journal. 1963; 39: 11-14.

19. Hughes KL, Edwards MJ, Hartley WJ, Murphy S. Polyarthritis in calves caused by Mycoplasma sp. Veterinary record. 1966; 78: 276-281.

20. Cottew GS. Mycoplasmas isolated from cattle in Australia. Aust Vet J. 1970; 46: 378-381.

21. Shiel MJ, Coloe PJ, Worotniuk B, Burgess GW. Polyarthritis in a calf associated with a group 7 Mycoplasma infection. Aust Vet J. 1982; 59: 192 193.

22. Jain NC, Jasper DE, Dellinger JD. Cultural characters and serological relationships of some mycoplasmas isolated from bovine sources. J Gen Microbiol. 1967; 49: 401-410.

23. Biddle MK, Fox LK, Evans MA, Gay CC. Pulsed-field gel electrophoresis patterns of Mycoplasma isolates from various body sites in dairy cattle with Mycoplasma mastitis. J Am Vet Med Assoc. 2005; 227: 455-459.

24. Fox LK, Hancock DD, Mickelson A, Britten A. Bulk tank milk analysis: factors associated with appearance of Mycoplasma sp. in milk. J Vet Med B Infect Dis Vet Public Health. 2003; 50: 235-240.

25. Aitken SL, Corl CM, Sordillo LM. Immunopathology of mastitis: insights into disease recognition and resolution. J Mammary Gland Biol Neoplasia. 2011; 16: 291-304.

Citation

Chang J, Yu D, Liang J, Chen J, Wang F, Jiang Z, et al. Mycoplasma leachii Causes Bovine Mastitis: Evidence from Clinical Symptoms,
Histopathology and Immunohistochemistry. Ann Appl Microbiol Biotechnol J. 2017; 1(1): 1003.

Other Articles

Article Image 1

Efficacy of a Combination of Plumbago Capensis and Aloe Secundiflora Aqueous and Methanolic Plant Extracts in the Treatment of Leishmania Major in Balb\C Mice

Background & Objectives: Monotherapy and combination therapy studies were to determine antileishmanial activities of the methanolic and water leaf extracts from Aloe secundiflora and Plumbago capensis.

Methods: The plants were analyzed by determining the Minimum Inhibition Concentration (MIC), Nitric Oxide (NO) production stimulation, Infection Rates (IR) and Multiplication Index (MI). Cytotoxicity of these plant extracts was also assessed.

Results: The MIC levels of water and methanolic plant extracts, amphotericin B and Pentostam were 2000μg/ml, 1000μg/ml, 125μg/ml and 250μg/ml respectively against Leishmania major promastigotes. Study revealed that water and methanolic plant extracts significantly inhibited the growth of Leishmania parasites (P≤0.05) as compared to amphotericin B with respect to the parasite infection rates and MIC levels. The IC50 for the water and methanolic plant extracts was 279.488μg/ml and 42.824μg/ml respectively. A similar extraction procedure was done for P.capensis. When administered orally, a combination of P.capensis and A.secundiflora proved to be more effective than that of the methanolic extract with LDU units of 4,800 and 15,300 respectively. Water extracts of P.capensis when used alone gave LDU of 5,200 units, methanolic extract gave 11,000 units. Aloe secundiflora water and methanolic extracts gave the same LDU of 10,700. Methanolic extract combinations of the two plants were the least effective, yielding the highest LDU of 21,000 units.

Interpretation & Conclusion: The results suggest that a combination oral therapy of extracts of the two plants and monotherapy using P.capensis can be effective methods of partially treating leishmaniasis.

Paul K Ndungu1, Johnstone M Ingonga1, Michael Gicheru2 and Christopher O
Anjili1

View HTML Download PDF
Article Image 1

Gene Therapy for Treatment of Melanoma Cancer

Melanoma occurs when the pigment-producing cells (melanocytes) that give colour to the skin become cancerous. Malignant melanoma has become one major problem for its higher rate of occurrence among patients than any other type of cancer throughout the world. Hence, it has become very crucial to treat melanoma skin cancers by early detection and prevention. It is remarkable how an advanced therapy like gene therapy is leading towards a better solution for melanoma skin cancer. Not only can gene therapy cure an individual, it also prevents same set of diseases throughout a blood line. With supported evidences from research and clinical trials, gene therapy also provides clue for a new generation treatment for different diseases including cancer.

Oisorjo Chakraborty, Aishwarya Mukherjee and Pranab Roy*

View HTML Download PDF
Article Image 1

Phylogenetic and Biochemical Analysis of the Reishi Mushroom (Ganoderma lucidum) Populations from Altai

G. lucidum is a typical representative of wood-rotting polypores of the Ganodermataceae family (Basidiomycetes). In Russia, G. lucidum is predominantly found in southern regions: in Stavropol and Krasnodar krais, Northern Caucasus, as well as in Altai taiga in logging areas. In this study we investigated the phylogeny of G. lucidum specimens from Altai based on the ITS1 ribosomal spacer, and compared them to reishi from other regions of the world. We also studied the phytochemical content of reishi fruit bodies. Results of the screening suggest that ethanol fractions contain mostly flavonoids, phenols, and coumarins; water fractions are dominated by tannins, carbohydrates, and coumarins; and hexane and ethyl acetate extracts, by terpenoids. The main fatty acids were palmitic, oleic, linoleic, and linolenic acids. We found that fruit bodies of Altai G. lucidum contained 32.4 mg of phenols per 1 g of extract (in pyrocatechol equivalent), while flavonoids made up 11.1 mg per g (in quercetin equivalent). Polysaccharide content was 10.72% of the absolutely dry substance.

Slynko NM, Blinov AG, Babenko VN, Mihailova SV, Bannikova SV, Shekhovtsov
SV, Nechiporenko NN, Goryachkovskaya TN, Veprev SG and Peltek SE*

View HTML Download PDF
Article Image 1

A Study on Mineralisation of Poly cis 1,4 isoprene (NR) and Synthetic Rubber Gloves (SRG) by the Bacterial Consortium

Objective: The aim of the study wasto isolate bacterial consortium from the effluent contaminated site that is used in the mineralizing both natural rubber and synthetic rubber, to optimise the growth conditions for efficient mineralisation and to biochemically characterise and to use 16s RNA sequencing for identifying the bacterial strains.

Materials and Methods: Natural rubber mineralizing bacterial consortium was isolated from effluent contaminated soil. The mineralisation study was performed for five days at every 24 h interval. Optimization studies were performed with different parameters such as varying concentrations of latex, pH, carbon sources, nitrogen sources, mixed carbon and nitrogen source and different temperature. The bacterial consortium mineralizing nr latex was used to mineralize Synthetic Rubber Gloves (SRG) using the same medium for 40 days at every 5 days interval. Effect of pre-treatment was studied by pre-treating the SRG with acetone and exposing it to sunlight. Mineralisation of the Rubber was confirmed by spectrophotometric and Fourier Transform Infra-Red
(FTIR) studies.

Results: Isolated organism was identified as Enterobater cloacae, Microbacterium laevaniformans and Methylobacterium rhodesianum. Maximum mineralisation of (1.66x10-4) was shown on the 4th day of incubation. Conformation of NR degradation was done by FTIR analysis that shows the presence of aldehyde and ketone produced due to bacterial degradation. The parameters giving optimum results were concentration of latex -1%, pH- 8.5, carbon source- Xylose, nitrogen source - Ammonium Nitrate, temperature- 37°C. Maximum mineralisation of synthetic rubber was shown on the 20th day (1.3x10-4). Among the pre-treated and the untreated samples most prominent distortions were visible on the surface of the sunlight sample when visualized under
scanning electron microscopy.

Conclusion: From the present investigation, it can be concluded that the isolated bacterial consortium containing the strains Enterobater cloacae, Microbacterium laevaniformans and Methylobacterium rhodesianum were able to mineralize natural rubber as well as synthetic rubber. This could be applied in the removal of waste rubber products present in the environment.

Veenagayathri Krishnaswamy* and Nikita Ahongsangbam

View HTML Download PDF
Article Image 1

Application of Chitosan in the Control of Fungal Infections by Dermatophytes

Dermatophytes are a group of fungi that can invade keratinized tissues of humans and other animals and produce an infection called Dermatophytosis. As chitosan possesses antimicrobial activity, it can potentially be used to treat dermatophytic infections. The main objective of this work was therefore, to evaluate the antifungal activity of chitosan upon some dermatophytes, namely Microsporum canis and Trychophyton rubrum. In view of this, Minimum Inhibitory (MICs) and Minimum Fungicidal Concentrations (MFCs) of chitosans upon the fungi were determined. Moreover, in order to understand the effect of chitosan on fungal activity, hair was infected with these fungi in the presence and absence of chitosan and Scanning Electron Microscopy (SEM) images were obtained and analyzed. Lastly, keratin-azure was used as substrate to evaluate the effect of chitosan on keratin degradation by M. canis and T. rubrum. The results showed that chitosan possesses antifungal activity against T. rubrum and M. canis, presenting MICs and MFCs ranging from 1.1 to 2.2 mg/mL. The antifungal activity of chitosan is concentration dependent. The analysis of SEM images of hair infected with these dermatophytes revealed that chitosan seems to have a protective effect on the hair, reducing the extent of damage when compared to the control. Chitosan also displayed important activity in preventing proteases’ action and in preventing hair damage. Based on the obtained results, it’s possible to conclude that chitosan showed relevant antifungal activity against dermatophytes, which opens good prospects to the use of chitosan as an alternative for the conventional fungal treatments.

Ana I Lopes, Freni K Tavaria* and Manuela E Pintado

View HTML Download PDF
Article Image 1

Characterization of Endophyte Microbiome Diversity in Chia Plant (Salvia hispanica L.)

A total of 9347 fungal and bacterial endophytes were isolated from the roots, stem and leaves of chia plant. Roots harbored more number of fungal endophytes than either stem or leaves whereas stem supported more number of bacterial endophytes than either roots or leaves. The nutritious plant supported more of gram negative compared to gram positive bacterial endophytes. The most common bacteria isolated were Pseudomonas Bacillus, and Cocci. The fungal endophytes isolated from root, stem and leaves of the chia plant showed the presence of Penincillium, Aspergillus, Fusarium, and Macrophomina spps. Dominant fungal endophyte was Aspergillus spp. which was found in all the plant parts instigated. Roots of the plant possessed maximum nitrogen fixers followed by stem and leaves. A proportion of 55% for the bacterial endophytes isolated from the plant chia plant were able to fix nitrogen whereas 25% were able to solubilize phosphorous. The phosphate solubilization efficiency was found to be highest for the Aspergillus spp at 83%.

Jasira Jzar1 , Mary Simiyu2 , Joseph Mafurah2*, Joshua Ogendo2 and Anne Osano3

View HTML Download PDF
Article Image 1

Isolation and Screening of Novel Isolates of Bifidobacteria from Human Milk as Potential Probiotic with Antidiarrheal Activity

Aims:
The objectives of this research work were isolation of Bifidobacteria from the human milk and its Probiotic characterization such as low pH, bile and in-vitro antimicrobial activity against diarrhea causing pathogen.

Methodology and Results:
In this research work, 47 bifidobacterial isolates were isolated from the human milk of the 50 lactating women and identified by using phenotypic methods. The isolates were examined in-vitro for their tolerance to unfavorable condition at low pH of 2 and 4 and at different concentrations of bile 0.3%, 0.5% and 1%. Further the isolates were tested for the antimicrobial activities by using diarrhea causing indicator stains such as E. coli, Salmonella enterica and Shigella boydii. Antibiotic susceptibility test was performed for the isolates which showed zone of inhibition in antimicrobial testing. Based on the result of in-vitro Probiotic test, the best four isolates Dbs18, Smk9, Smk4 and Smk5 were selected for further evaluation of tolerance test of phenol (0.1%, 0.2%, 0.4%), NaCl (5%, 8%, 12%). Auto aggregation and hydrophobicity assay were also done for the four selected isolates. In in-vitro test of low pH, out of 47 isolates only 14 isolates were able to grow whereas in bile tolerance assay most of the isolates grew well at 0.3% bile concentration but variability of growth of isolates were observed at 0.5% and 1% bile. In antimicrobial assay, 15 isolates out of 47 isolates showed antimicrobial activity after ruling out the inhibitory activity of low pH. In NaCl and phenol tolerance test all the four selected isolates were able to survive the different concentration of phenol and NaCl. The percentage of hydrophobicity and auto aggregation was highest in Dbs18 followed by Smk9 among the four isolates.

Conclusion, significance and impact of study:
Among the four isolates Dbs18 and Smk9 showed good hydrophobicity and auto aggregation ability. These bifidobacterial isolates Dbs18 and Smk9 are found to possess desirable Probiotic properties and will be selected for the in-vivo test and molecular identification will be done for the selected isolates. These bifidobacterial strains may act as a potential candidate of novel Probiotic strain isolated from human milk for the treatment of bacterial gastrointestinal diarrhea.

Sangeeta Huidrom* and Narotam Sharma

View HTML Download PDF
Article Image 1

Improving Bioelectricity Generation of Microbial Fuel Cell (MFC) With Mediators Using Kitchen Waste as Substrate

The enhancement of bioelectricity generation in the Microbial Fuel Cell (MFC) necessitated the introduction of exogenous compound (s) (i.e. mediators). The effect of 1ml of various synthetic exogenous mediators including dyes and metallorganics such as Ethylene Diamine Tetra Acid [EDTA], potassium ferricyanide [K3 Fe(CN)6 ], methylene blue [MB], neutral red [NR] and potassium permanganate [KMnO4 ] was investigated in a 21day study during electricity generation in an MFC. The maximum Power Density (PD) obtained without the addition of any mediator was 84.58mW/m2, while those MFCs which utilized mediators recorded higher energy yield. The highest power density and percentage energy contribution of 924.79mW/m2 (993.39%) was obtained using K3 Fe(CN)6, while values obtained with EDTA [803.71mW/m2 (850.24%)]; MB [340.45mW/m2 (302.52%)] and KMnO4 [192.14mW/m2 (121.17%)] as mediators were appreciably higher. Further study on the use of these mediators showed inhibitory effects with the % reduction of microbial load in the following trend as MB (4.96%) < EDTA (6.13%) < NR (11.67%) < Ferricyanide (19.16%) < KMnO4 (21.89%) when compared to the control. Although the application of mediators improved energy production, minimum inhibitory concentration of the mediators should be ascertained to prevent the eradication of electrogens during electricity production.

Adebule AP*, Aderiye BI and Adebayo AA 

View HTML Download PDF
Article Image 1

Bacillus Cereus Bacterium: A Human Pathogen

Bacteria belonging to genus Bacillus are endospore-forming bacteria Gram-positive and aerobic that are distinguished by the rod-designed cell morphology. Besides, they are found in varied environments. Bacillus sp., is known to have an economic interest. In fact, various strains or species are employed in animal and human food manufacture. Among Bacillus sp., Bacillus cereus is particularly dangerous for humans. This bacterium is a source of food toxin and involves severe infections.

Karim Ennouri* 

View HTML Download PDF
Article Image 1

Improvement and Stable High Bioelectricity Generation Using Alkaliphilic Oceanobacillus iheyensis BS1(2) in Microbial Fuel Cells and Effect of Different Anodic Operating Conditions

Microbial fuel cells (MFCs), which can be use bacterial cultures as biocatalyst for the conversion of chemical energy into the electricity from the biomass. The bacteria that can be able to synthesis the electron from biodegradation of organic content and transfer the electron are known as exoelectrogen. The objective of this study was to investigate the electricity generation from the extremophilic bacterium isolated from Lonar Lake (India). Oceanobacillus iheyensis BS1(2), an alkalophilic, Gram-positive, spore forming, was isolated from the anode of a lonar lake sediment MFC that was continuously operated under pH 10.0. Before the culture transfer in anode, strain Oceanobacillus iheyensis BS12 was aerobically cultivated in medium Horikoshi II medium. A totally fifty seven bacterial culture were isolated, from which BS12 was selected for the further investigation of MFC. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain BS1(2) was affiliated with the genus Oceanobacillus. The experimental results performed that the strain BS1(2) was capable of utilizing organic acids and sugars as electron donors to generate electricity. The MFC was constructed and the electricity generation was measured after various intervals using various parameters, 644mV electricity was generated after 1h, but after 48h the electricity generation dramatically decreases 420mV. The effect of pH on MFC was also studied, pH enhanced electricity (644mV), indicating requirement of pH for bacterium BS12. The present studies, thus serve in finding the proximate values of these course features which basic consequence in optimum bioelectricity generation.

Vishal Dhundale¹, Vijayshree Hemke², Dhananjay Desai¹, Gayatri Aher¹, Pinky Khemchandani¹, Parthsarathi Dikonda¹, and Bharati Thosare¹

View HTML Download PDF